Sheldons Notes

From Evolutionary Informatics Working Group
Jump to: navigation, search

Sheldon's notes:


(Back to Visualization Subgroup)

Notes on Visualization project

User interface notes

  • ported iplant AJAX/Phylowidget implementation, with treebase data backend
  • made more generic
  • JavaScript components based on YAHOO user interface
  • Server-side components incle perl/CGI/DBI scripts for database interactions
    • Will be replaced by NeXML back end as soon as feasible
  • General features: Asynchronous queries, resizeable/draggable panels

Panels

Search panel
launch and browse database queries
PhyloWidget
contains the Java Applet
Tree Data
will have read-only NeXML data, updated dynamically as tree is edited
Node decoration editor
interface for tree decoration on node that is in focus
  • line color, width
  • node shape/size/color
  • label color/size
Node info
interface for editing and displaying node data and any associated annotations

Getting some NeXML data

NOTE: This track has been abandoned due to duplication of effort

  1. NEXUS tree file
  2. semantically marked-up NeXML character matrix

Installing Bio::Phylo

  • Installed from CPAN shell, passed tests
  • the example nexus file did not parse: error message "innapropriate ioctl for device" (How and where did you run this? --Rvos@interchange.ubc.ca 00:24, 11 March 2009 (EDT))
  • the example neXML file did not parse: error message was that Bio::Phylo::Nexus was not found" (The example file is not valid. Also, what was the exact message - it couldn't have been that? --Rvos@interchange.ubc.ca 00:24, 11 March 2009 (EDT))


 Error Message:
Message: Invalid data for row GTAGTTCTACCTATAGAAAAGATCATGAAAGAGGCGATCAGAATGGTACTCGAATTCATTTACGATTC\
AGAGTTTCCAGACACATCGCACTTTCGCTCGG (type Dna: ' A r a b i d o p s i s ')